gef

Information for gef, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 15445-16557 + CDS yi81_1 - IS186 hypothetical protein 16751-16960 - CDS gef EG12074 Gef protein interferes with membrane function when in excess 17489-18655 + CDS nhaA EG10652 Na+/H antiporter; pH dependent

Reported regulatory sites for gef: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.012 17027-17049 R cgggt GCTTGAGGCTGTCTGTCTCAGGC attag - 0 - 1.740 16998-17015 R tgaac GGCAGATAGAGAAAAGCC ccgag - 0 - 0.677 17250-17271 R gggat TAATTAGGAAAAGTAATAATTA atttg - 0 - 0.677 17132-17153 R ttaaa TAATTAAATCATTAAAAAATTA cgcca - 0 -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back