ggt

Information for ggt, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3582390-3582674 + CDS yrhB EG12948 orf; hypothetical protein 3582712-3584454 - CDS ggt EG10374 gamma-glutamyltranspeptidase 3584574-3585014 + CDS yhhA EG11184 orf; hypothetical protein

Reported regulatory sites for ggt: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.125 3584457-3584474 R gcccc TTAATCTCTGGAGAATAA cgatg - 0 - 1.189 3584501-3584522 R acaaa ACGATGATTAATTCAGAGTTAT atacc - 0 - 0.709 3584524-3584542 R ttaag TTTACTCGCTTCCCGACAA aacga - 0 -

Critical MAP values: p=0.01 6.66 p=0.05 5.31 p=0.1 4.59 p=0.2 3.95

Click here to go back