glcD

Information for glcD, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3122252-3124537 - CDS glcF EG13291 glycolate oxidase iron-sulfur subunit 3124537-3126036 - CDS glcD EG12997 glycolate oxidase subunit D 3126287-3127051 + CDS glcC EG12998 transcriptional activator for glc operon

Reported regulatory sites for glcD: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.298 3126256-3126272 R tcgtg CACAGGTAGGACCAATT tttct - 0 - 3.298 3126139-3126155 R aaaaa AAATGGTCTGACCGGTA gctaa - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.554 3126193-3126210 R gatta TGTTACATCAATTTAACA ttgag arcA 14 - - 0.549 3126213-3126235 R cgcaa AACACGCACATCACGTAAGTGAT tatgt arcA 23 -

Critical MAP values: p=0.01 3.34 p=0.05 2.41 p=0.1 2.01 p=0.2 1.55

Click here to go back