glk

Information for glk, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2505936-2506262 - CDS b2387 EG14155 putative PTS system enzyme IIB component 2506481-2507446 - CDS glk EG12957 glucokinase 2507650-2508906 + CDS b2389 EG14156 orf; hypothetical protein

Reported regulatory sites for glk: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.862 2507555-2507578 R ggtgc TGAAACGATAAAGTAATTGTGTGA cccag - 0 - 2.862 2507484-2507507 R tgtta TGCCCCCAGGTATTTACAGTGTGA gaaag - 0 - 2.596 2507464-2507482 R gtgag AAAGAATTATTTTGACTTT agcgg - 0 - 2.168 2507582-2507598 R aaaaa GGCATCGCTGCAATTGG tgctg - 0 -

Critical MAP values: p=0.01 6.66 p=0.05 5.31 p=0.1 4.59 p=0.2 3.95

Click here to go back