glmU

Information for glmU, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3909467-3911296 - CDS glmS EG10382 L-glutamine:D-fructose-6-phosphate aminotransferase 3911458-3912828 - CDS glmU EG11198 N-acetyl glucosamine-1-phosphate uridyltransferase 3913181-3913600 - CDS atpC EG10100 membrane-bound ATP synthase; F1 sector; epsilon-subunit

Reported regulatory sites for glmU: Genome coordinates Source Transcription factor Transcription factor annotation 3912886-3912908 DPInteract nagC transcriptional repressor of nag (N-acetylglucosamine) operon 3913039-3913061 DPInteract nagC transcriptional repressor of nag (N-acetylglucosamine) operon

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.896 3912889-3912905 R tgtcc ATTTCACGATGAAAAAA atgta nagC 17 - 2.896 3912866-3912882 R tgtag TTTTTTCAAGGTGAAGC ggttt - 0 - 1.958 3912916-3912937 R gggga TAATCCGTTATTGAACAATTTA tcctc - 0 - 1.656 3913129-3913151 R cagtc TGGAAACAGGCTGGCTTTTTTTT gcgcg - 0 - 1.656 3912841-3912863 R agcgg TTTAAATTCGTTCTCAAATTACA gtcag - 0 -

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back