glnD

Information for glnD, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 185123-185947 - CDS dapD EG10207 2;3;4;5-tetrahydropyridine-2-carboxylate N-succinyltransferase 185978-188650 - CDS glnD EG11411 protein PII; uridylyltransferase acts on regulator of glnA 188712-189506 - CDS map EG10570 methionine aminopeptidase

Reported regulatory sites for glnD: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.981 188688-188707 R agatg AAGCCGGCGAATGCCGGCTT tttta - 0 - 1.775 188675-188695 R cgaat GCCGGCTTTTTTAATGCGATA attta - 0 - 0.456 188662-188678 R aatgc GATAATTTAATCTTATG ggtgg - 0 -

Critical MAP values: p=0.01 7.30 p=0.05 6.05 p=0.1 5.26 p=0.2 4.60

Click here to go back