glnH

Information for glnH, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 845683-846342 - CDS glnP EG10388 glutamine high-affinity transport system; membrane component 846481-847227 - CDS glnH EG10386 periplasmic glutamine-binding protein; permease 847631-848134 - CDS dps EG11415 global regulator; starvation conditions

Reported regulatory sites for glnH: Genome coordinates Source Transcription factor Transcription factor annotation 847279-847326 DPInteract ihf integration host factor (IHF) 847371-847400 DPInteract ntrC response regulator for gln (sensor glnL) (nitrogen regulator I NRI)

Species with an ortholog: PA ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.587 847454-847475 R atcac ACAATCGTTACATAAAGATTGT ttttt - 0 - 4.163 847529-847545 R ctcaa CGCACTTATTTAGTGCA tccat - 0 - 4.163 847397-847413 R ttgag TGCACAATTTTAGCGCA ccaga ntrC 4 - 3.071 847282-847297 R aaaac TGGCACGATTTTTTCA tatat ihf 16 -

Critical MAP values: p=0.01 6.66 p=0.05 5.31 p=0.1 4.59 p=0.2 3.95

Click here to go back