glnK

Information for glnK, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 469860-471641 + CDS mdlB EG14374 putative ATP-binding component of a transport system 471822-472160 + CDS glnK EG12191 nitrogen regulatory protein P-II 2 472190-473476 + CDS amtB EG11821 probable ammonium transporter

Reported regulatory sites for glnK: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.702 471665-471681 gttgg TGCAAAAATGTAACGCA ctgtg - 0 - 2.702 471685-471701 cactg TGCACTGTCATAGTGCG ttttc - 0 - 2.537 471751-471773 ttcat TTCTGGCACACCGCTTGCAATAC cttct - 0 - 0.064 471793-471816 agaac CATTACCGAATTCTGACCGGAGGG gatct - 0 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back