glnP

Information for glnP, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 844964-845686 - CDS glnQ EG10389 ATP-binding component of glutamine high-affinity transport system 845683-846342 - CDS glnP EG10388 glutamine high-affinity transport system; membrane component 846481-847227 - CDS glnH EG10386 periplasmic glutamine-binding protein; permease

Reported regulatory sites for glnP: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.381 846349-846372 R tttga TTATTTACACCACGGTAACAGGAA caaca - 0 - 1.106 846394-846414 R tgagg GGCGCAAACCCGCTCCGGGGC catta - 0 BOXC11 (6) 0.433 846445-846463 R tgtaa AACGCACTGGCAGTTCCCT ctccc - 0 BOXC11 (7)

Critical MAP values: p=0.01 6.66 p=0.05 5.31 p=0.1 4.59 p=0.2 3.95

Click here to go back