glnS

Information for glnS, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 703167-705113 + CDS nagE EG10635 PTS system; N-acetylglucosamine-specific enzyme IIABC 705316-706980 + CDS glnS EG10390 glutamine tRNA synthetase 707557-708963 + CDS ybfM EG13659 orf; hypothetical protein

Reported regulatory sites for glnS: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.776 705262-705283 ctgtc CCGCTTATAAGATCATACGCCG ttata - 0 - 1.311 705237-705253 tttta AAAAACTAACAGTTGTC agcct - 0 - 1.230 705167-705183 aagcg GTGGAGATCTTCTCTGC cgctt - 0 -

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back