gloA

Information for gloA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1724683-1725780 + CDS nemA EG13546 N-ethylmaleimide reductase 1725861-1726268 + CDS gloA EG13421 lactoylglutathione lyase 1726371-1727018 + CDS rnt EG11547 RNase T; degrades tRNA

Reported regulatory sites for gloA: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.871 1725813-1725834 ccgct ATACTAAAACAACATTTTGAAT ctgtt - 0 - 0.952 1725836-1725858 gaatc TGTTAGCCATTTTGAGGATAAAA agatg - 0 - 0.735 1725791-1725814 cattg CGAGCGGCGTAAAGCCGCCGCTAT actaa - 0 -

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back