glpE

Information for glpE, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3558255-3559085 - CDS glpG EG10397 protein of glp regulon 3559130-3559456 - CDS glpE EG10395 protein of glp regulon 3559646-3561151 + CDS glpD EG10394 sn-glycerol-3-phosphate dehydrogenase (aerobic)

Reported regulatory sites for glpE: Genome coordinates Source Transcription factor Transcription factor annotation 3559530-3559551 DPInteract crp cyclic AMP receptor protein

Species with an ortholog: PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.631 3559614-3559636 R ccctc ATTCACTTTCGTTAAAGCTCATA aatgt glpR 20 - 2.631 3559591-3559613 R tcata AATGTTCGTTATCGAACATATTA gcaaa glpR 20 - 2.266 3559537-3559559 R tgaaa AAACATTTTAGAGTGATATGTAT aacat crp 15 - 1.073 3559521-3559541 R tgata TGTATAACATTATGGCGTTTA tctgc crp 12 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back