glpF

Information for glpF, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 4113294-4114802 - CDS glpK EG10398 glycerol kinase 4114825-4115670 - CDS glpF EG10396 facilitated diffusion of glycerol 4116095-4116340 + CDS yiiU EG11878 orf; hypothetical protein

Reported regulatory sites for glpF: Genome coordinates Source Transcription factor Transcription factor annotation 4115791-4115812 DPInteract crp cyclic AMP receptor protein 4115766-4115787 DPInteract crp cyclic AMP receptor protein 4115811-4115830 DPInteract glpR repressor of the glp operon 4115790-4115809 DPInteract glpR repressor of the glp operon 4115769-4115788 DPInteract glpR repressor of the glp operon 4115749-4115768 DPInteract glpR repressor of the glp operon

Species with an ortholog: HI PA ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.699 4115810-4115831 R gaata AATGGCGCGATAACGCTCATTT tatga glpR crp 20 3 - 3.699 4115748-4115769 R ctcgt TTTTGCTCGTTAACGATAAGTT tacag glpR crp 21 4 - 2.041 4115781-4115797 R aggca CACACATTTTAAGTTCG atatt glpR crp 16 14 - 1.575 4115712-4115729 R caagc ATCGTGGAGGTCCGTGAC tttca - 0 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back