gltA

Information for gltA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 751452-752018 - CDS ybgD EG12359 putative fimbrial-like protein 752408-753691 - CDS gltA EG10402 citrate synthase 754400-754789 + CDS sdhC EG10933 succinate dehydrogenase; cytochrome b556

Reported regulatory sites for gltA: Genome coordinates Source Transcription factor Transcription factor annotation 754137-754168 PMID: 8892825 arcA negative response regulator of genes in aerobic pathways (sensors ArcB and CpxA) 754025-754087 PMID: 8892825 arcA negative response regulator of genes in aerobic pathways (sensors ArcB and CpxA)

Species with an ortholog: PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.371 754128-754147 R atcat TACAATTAACCTACATATAG tttgt arcA 11 - 2.371 754061-754080 R caaca TTTATTTAATTTTTAATCAT ctaat arcA 20 - 1.876 754021-754037 R aacaa AGTTGTTACAAACATTA ccagg arcA 13 - 1.727 753787-753803 R tttcc CCTCTTTCACAGAGCGG cgagc - 0 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back