gltJ

Information for gltJ, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 684478-685152 - CDS gltK EG12662 glutamate/aspartate transport system permease 685152-685892 - CDS gltJ EG12661 glutamate/aspartate transport system permease 686062-686970 - CDS ybeJ EG12700 putative periplasmic binding transport protein

Reported regulatory sites for gltJ: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.719 686010-686032 R ccagc CCTCTCGATTGTTACGTAGCACG gacag - 0 - 3.719 685974-685996 R atacg CCTGATGGTCGTTCCCCATCGGG cctga - 0 REPt58 (23) 3.445 685914-685930 R gtagc AGTTAACGCTGCTACCC tcttt - 0 - 3.377 685932-685947 R ggtaa CAATCTTCGAGGGTAG cagtt - 0 -

Critical MAP values: p=0.01 6.66 p=0.05 5.31 p=0.1 4.59 p=0.2 3.95

Click here to go back