gltS

Information for gltS, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3822837-3824918 + CDS recG EG10829 DNA helicase; resolution of Holliday junctions; branch migration 3825087-3826292 - CDS gltS EG10406 glutamate transport 3826572-3827963 + CDS yicE EG11194 putative transport protein

Reported regulatory sites for gltS: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.462 3826469-3826491 R atcta AATATTTAAATGAGATAAATGCA ctttt - 0 - 1.462 3826428-3826450 R ctttt GGTATTTTTCTGCTTAAAATCCA tgcca - 0 - 1.440 3826536-3826552 R tggta GCAAAGCGGGCATTTTA gctga - 0 - 1.440 3826506-3826522 R aaaga GAAAAGCAAACGTTTGC cacat - 0 - 0.334 3826404-3826425 R ccatg CCATTTGTTCATTAACAGCTGA gaatt - 0 - 0.334 3826377-3826398 R gaatt TGACCCAGGAAAGCATAACTCG atacc - 0 -

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back