gmhA

Information for gmhA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 240859-243339 - CDS yafH EG13145 putative acyl-CoA dehydrogenase (EC 1.3.99.-) 243543-244121 + CDS gmhA EG13146 phosphoheptose isomerase 244327-245094 + CDS yafJ EG13147 putative amidotransferase

Reported regulatory sites for gmhA: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.384 243492-243509 ggcgg TATCCGGTACACTGCATT ttgtc - 0 - 2.874 243369-243388 tgtaa AAACATTTAGCAATATGTTT acaat - 0 - 2.874 243401-243420 aatta CAACAAAGCTCACATTGTTG ctgtt - 0 - 2.049 243522-243539 ttaca TTTATGCTGAAGGATATC ctcat - 0 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back