gmk

Information for gmk, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3817115-3818803 - CDS yicF EG11334 putative enzyme 3819055-3819678 + CDS gmk EG10965 guanylate kinase 3819733-3820008 + CDS rpoZ EG10899 RNA polymerase; omega subunit

Reported regulatory sites for gmk: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.576 3818946-3818969 aaacg CAACAACTTTGCGCAAAAAGTGTG agcaa - 0 - 1.095 3819023-3819039 taggc TTTATTTCGCTAATCAC atacg - 0 - 0.970 3818994-3819016 ggccg CGCCGTGTATAATAAGCTCGTAT gtagg - 0 -

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back