gppA

Information for gppA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3958292-3960313 + CDS rep EG10837 rep helicase; a single-stranded DNA dependent ATPase 3960360-3961844 - CDS gppA EG10413 guanosine pentaphosphatase; exopolyphosphatase 3961980-3963245 - CDS rhlB EG10844 putative ATP-dependent RNA helicase

Reported regulatory sites for gppA: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.124 3961930-3961953 R atcat TCAAACTGTATCAAGATGGCAAGA gaatg - 0 IRU15 (24) 2.124 3961857-3961880 R agaat GCAGCCAACACAGAGACAGATTGA aggat - 0 IRU15 (24) 1.240 3961909-3961925 R agaat GAATCCCGATGAGCTTA ctgta - 0 IRU15 (17) 0.993 3961945-3961967 R atgtc ATACTCAAAATCATTCAAACTGT atcaa - 0 IRU15 (23)

Critical MAP values: p=0.01 6.03 p=0.05 4.63 p=0.1 3.98 p=0.2 3.37

Click here to go back