gpt

Information for gpt, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 254259-255716 - CDS pepD EG10695 aminoacyl-histidine dipeptidase (peptidase D) 255977-256435 + CDS gpt EG10414 guanine-hypoxanthine phosphoribosyltransferase 256527-257771 + CDS yafA EG11091 orf; hypothetical protein

Reported regulatory sites for gpt: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.207 255901-255917 ccaga TCTCTATAATCTCGCGC aacct - 0 - 3.468 255875-255890 catgt GAAATACTGGTTTTTA gtgcg - 0 - 2.770 255938-255959 cgaac ACTTTTTAAGCCGTAGATAAAC aggct - 0 -

Critical MAP values: p=0.01 6.03 p=0.05 4.63 p=0.1 3.98 p=0.2 3.37

Click here to go back