grxA

Information for grxA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 889312-889689 + CDS ybjM EG13682 orf; hypothetical protein 889719-889976 - CDS grxA EG10417 glutaredoxin1 redox coenzyme for glutathione-dependent ribonucleotide reductase 890136-890423 + CDS ybjC EG12842 orf; hypothetical protein

Reported regulatory sites for grxA: Genome coordinates Source Transcription factor Transcription factor annotation 890033-890075 PMID: 9497290 oxyR activator hydrogen peroxide-inducible genes

Species with an ortholog: HI SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.655 890035-890051 R aatgc AACAGGTTAAACCTACT ttcag oxyR 17 - 2.374 890050-890071 R agtta TAGCTTTTAGCAATTAATGCAA caggt oxyR 22 - 1.343 890003-890026 R agcga ATACATTTTAGCGTGATCATTACA ggcat - 0 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back