grxB

Information for grxB, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1121936-1122496 - CDS yceB EG11117 orf; hypothetical protein 1122630-1123277 - CDS grxB EG12688 glutaredoxin 2 1123341-1124579 - CDS yceL EG13878 orf; hypothetical protein

Reported regulatory sites for grxB: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC VC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.603 1123318-1123341 R gcctg ATTTGATACTCCCCCCTGACTCCT tcata - 0 - 2.318 1123288-1123304 R aaagt GAACTGACAGCCAAATG gagga - 0 -

Critical MAP values: p=0.01 6.82 p=0.05 5.66 p=0.1 5.03 p=0.2 4.36

Click here to go back