grxC

Information for grxC, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3781288-3781755 - CDS secB EG10937 protein export; molecular chaperone; may bind to signel sequence 3781818-3782069 - CDS grxC EG12294 glutaredoxin 3 3782211-3782642 - CDS yibN EG12295 orf; hypothetical protein

Reported regulatory sites for grxC: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.259 3782175-3782192 R tttca TGATGCAGGCCGTTAGCT gcaat - 0 IRU14 (18) 2.259 3782104-3782121 R cattt TGCTGCCGCCCTGCAACA tgaaa - 0 IRU14 (18) 1.883 3782130-3782153 R cgact TATTGTTATAAGCTTCTGGGGACA ctcca - 0 IRU14 (24) 0.788 3782070-3782086 R gtaaa AAAACAGGAGCTAATTT atggc - 0 -

Critical MAP values: p=0.01 6.66 p=0.05 5.31 p=0.1 4.59 p=0.2 3.95

Click here to go back