gshA

Information for gshA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2812239-2812754 - CDS ygaG EG12712 orf; hypothetical protein 2812905-2814461 - CDS gshA EG10418 gamma-glutamate-cysteine ligase 2814534-2814962 - CDS b2689 EG13529 orf; hypothetical protein

Reported regulatory sites for gshA: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.552 2814462-2814482 R acgat TTTGACAGGCGGGAGGTCAAT ttgat - 0 - 2.476 2814492-2814508 R tcacc ATTACAGTTATGCTAAT taaaa - 0 - 2.289 2814475-2814496 R ttatg CTAATTAAAACGATTTTGACAG gcggg - 0 -

Critical MAP values: p=0.01 6.03 p=0.05 4.63 p=0.1 3.98 p=0.2 3.37

Click here to go back