gsk

Information for gsk, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 498238-499197 - CDS ybaC EG11101 putative lipase (EC 3.1.1.-) 499349-500653 + CDS gsk EG11102 inosine-guanosine kinase 500786-502462 - CDS ybaL EG12623 putative transport protein

Reported regulatory sites for gsk: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 0.926 499296-499315 cgctc CCGTCAGATTGTGTTAACAT tcgcc - 0 - 0.918 499208-499231 aactc CTTTCAAATTACGTCATTGTAAGG aacca - 0 - 0.451 499250-499272 aaaat GCGATCCCGCCTGCTGATATTGA aactg - 0 -

Critical MAP values: p=0.01 6.03 p=0.05 4.63 p=0.1 3.98 p=0.2 3.37

Click here to go back