gsp

Information for gsp, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3132887-3134386 - CDS pitB EG12883 low-affinity phosphate transport 3134678-3136537 - CDS gsp EG12882 glutathionylspermidine synthetase/amidase 3136694-3137608 + CDS b2989 EG13005 orf; hypothetical protein

Reported regulatory sites for gsp: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.694 3136641-3136664 R taacc CTTTGCGCCAGCCGCTGCGATGAG gtgta - 0 - 2.694 3136599-3136622 R ctgac CTCTGTCCGGTTAATGTCGCTGAG caggt - 0 - 0.000 3136665-3136688 R ttgct GTACAGAATGTGAATTTTTTAACC ctttg - 0 -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back