guaC

Information for guaC, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 112599-113219 - CDS yacE EG12312 putative DNA repair protein 113444-114487 + CDS guaC EG10422 GMP reductase 114407-114514 - CDS b0105 - orf; hypothetical protein

Reported regulatory sites for guaC: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 5.290 113320-113342 gtaaa TTTATGGGATTGTAGCGTAAAAA aagac - 0 - 3.125 113373-113396 cattg ATTAGTGCGTATGATAGCGTCACT ggagt - 0 - 1.652 113343-113361 aaaaa AAGACAATTTCGCAGTCTT gcgcc - 0 -

Critical MAP values: p=0.01 6.66 p=0.05 5.31 p=0.1 4.59 p=0.2 3.95

Click here to go back