gyrA

Information for gyrA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2332976-2334712 - CDS yfaA EG11142 orf; hypothetical protein 2334813-2337440 - CDS gyrA EG10423 DNA gyrase; subunit A; type II topoisomerase 2337587-2338309 + CDS ubiG EG11143 3-demethylubiquinone-9 3-methyltransferase and 2-octaprenyl-6-hydroxy phenol methylase

Reported regulatory sites for gyrA: Genome coordinates Source Transcription factor Transcription factor annotation 2337575-2337594 DPInteract cspA cold shock protein 7.4 transcriptional activator of hns 2337555-2337574 DPInteract cspA cold shock protein 7.4 transcriptional activator of hns 2337527-2337546 DPInteract cspA cold shock protein 7.4 transcriptional activator of hns 2337493-2337545 PMID: 10594821 fis site-specific DNA inversion stimulation factor; DNA-binding protein; a trans activator for transcription

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.476 2337459-2337475 R gacct TTGAATCCGGGATACAG tagag - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.762 2337476-2337496 R cgcgg CTGTGTTATAATTTGCGACCT ttgaa fis 4 - 1.690 2337442-2337458 R tacag TAGAGGGATAGCGGTTA gatga - 0 -

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back