hdeD

Information for hdeD, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3654038-3654370 - CDS hdeA EG11398 orf; hypothetical protein 3654625-3655197 + CDS hdeD EG11495 orf; hypothetical protein 3655996-3656523 + CDS yhiE EG11544 orf; hypothetical protein

Reported regulatory sites for hdeD: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.776 3654475-3654496 atcaa AATCAGATATTTTTATTTCAAT acaat - 0 - 2.776 3654527-3654548 actgc AATTAGGAAATTTTTATTAAAT cgact - 0 - 0.530 3654447-3654470 ttctg TATATGTCATGTTGATGGAAAATA tcaaa - 0 - 0.530 3654558-3654581 tgcat TCTTAGACGCGTTTTTGGCATAGA ttgat - 0 -

Critical MAP values: p=0.01 5.55 p=0.05 3.60 p=0.1 3.00 p=0.2 2.32

Click here to go back