helD

Information for helD, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1023125-1023571 - CDS yccF EG12306 orf; hypothetical protein 1023694-1025748 + CDS helD EG10426 DNA helicase IV 1025780-1026247 - CDS mgsA EG12307 methylglyoxal synthase

Reported regulatory sites for helD: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.912 1023572-1023595 cgcat AAAACCTCGCTTTACTGTGGTTTT cagta - 0 - 1.884 1023619-1023638 gtaac GTTTTTTTGGGCTGGAGCAC gtttt - 0 - 1.884 1023639-1023658 agcac GTTTTCTCTGACGGTTACAC tgata - 0 - 0.295 1023661-1023679 cactg ATAAGAAATAATTTCGTGT ggatc - 0 -

Critical MAP values: p=0.01 6.66 p=0.05 5.31 p=0.1 4.59 p=0.2 3.95

Click here to go back