hemA

Information for hemA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1262100-1262723 - CDS hemM EG11293 an enzyme in main pathway of synthesis of 5-aminolevulinate; possibly glutamyl-tRNA dehydrogenase 1262937-1264193 + CDS hemA EG10427 enzyme in alternate path of synthesis of 5-aminolevulinate 1264235-1265317 + CDS prfA EG10761 peptide chain release factor RF-1

Reported regulatory sites for hemA: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.133 1262878-1262893 cttac GCATCCTGTATGATGC aagca - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.100 1262903-1262926 agact AACCCTATCAACGTTGGTATTATT tcccg - 0 - 2.019 1262860-1262876 gcgct CTCTTTTATTGATCTTA cgcat - 0 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back