hemB

Information for hemB, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 387019-387870 + CDS tauD EG12423 taurine dioxygenase; 2-oxoglutarate-dependent 387977-388984 - CDS hemB EG10428 5-aminolevulinate dehydratase = porphobilinogen synthase 389121-389390 - CDS b0370 - orf; hypothetical protein

Reported regulatory sites for hemB: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.210 389011-389030 R caaca TCGCGACAACTTTCGTAAAA catcc - 0 - 0.946 389071-389092 R tataa AATTATTGCTGTTTCTATTAAA aagat - 0 - 0.664 389093-389111 R taaaa ATATTTTCAGTGAATATAA aatta - 0 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back