hemC

Information for hemC, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3986701-3987441 - CDS hemD EG10430 uroporphyrinogen III synthase 3987438-3988400 - CDS hemC EG10429 porphobilinogen deaminase = hydroxymethylbilane synthase 3988766-3991312 + CDS cyaA EG10170 adenylate cyclase

Reported regulatory sites for hemC: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 6.489 3988593-3988614 R tctaa AACGTGATCAATTTAACACCTT gctga crp 21 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.296 3988623-3988646 R ctggt TTTTTTAGTTTCACGACGAAAAAA tggtc - 0 - 2.752 3988723-3988743 R gctac CCGTCATGACTGTGATTCCGC caaca - 0 - 2.752 3988572-3988592 R acctt GCTGATTGACCGTAAAGAAAG atgcg - 0 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back