hemG

Information for hemG, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 4030735-4032033 + CDS trkH EG11021 potassium uptake; requires TrkE 4032197-4032742 + CDS hemG EG11485 protoporphyrin oxidase 4033120-4034661 + rRNA rrsA EG30084 16S RNA of rrnA operon

Reported regulatory sites for hemG: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.228 4032160-4032181 gctct TTACCCCGACTTTCTGGCGTGA atgat - 0 - 3.187 4032033-4032055 cattg AATAACCTGGGGCCAGGGCTTGG cgtgg - 0 - 2.132 4032132-4032153 gtcgt CTCGAGGTCTTTACATTGCTGG tgctc - 0 -

Critical MAP values: p=0.01 6.03 p=0.05 4.63 p=0.1 3.98 p=0.2 3.37

Click here to go back