hemH

Information for hemH, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 496399-497043 + CDS adk EG10032 adenylate kinase activity; pleiotropic effects on glycerol-3-phosphate acyltransferase activity 497279-498241 + CDS hemH EG10431 ferrochelatase: final enzyme of heme biosynthesis 498238-499197 - CDS ybaC EG11101 putative lipase (EC 3.1.1.-)

Reported regulatory sites for hemH: Genome coordinates Source Transcription factor Transcription factor annotation 497190-497232 PMID: 11443091 oxyR activator hydrogen peroxide-inducible genes

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.784 497203-497219 tttga CCTCTCACAGCAATTAG ttctt oxyR 17 - 1.784 497254-497270 atcaa CAAGTTGAATCGATAAG aggcg - 0 - 1.727 497133-497148 cagca ATCTCAGGCCGGATAT tcatt - 0 REPt45 (9) 0.872 497153-497174 ttcat TCGGCCTTTTACAAAAACCTCA atctg - 0 REPt45 (5)

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back