hemL

Information for hemL, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 171462-173444 + CDS fhuB EG10303 hydroxamate-dependent iron uptake; cytoplasmic membrane component 173602-174882 - CDS hemL EG10432 glutamate-1-semialdehyde aminotransferase (aminomutase) 175107-176528 + CDS yadQ EG12331 putative channel transporter

Reported regulatory sites for hemL: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.836 175078-175094 R tcact TATTGGTCATACAAATA agatg - 0 - 2.802 175025-175045 R catga AAATCCTTTGCAAAGCGTAAT gtttc - 0 - 2.705 174908-174926 R taaca TAGAATAGCAGCCATTCAC ttttt - 0 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back