hemM

Information for hemM, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1261249-1262100 - CDS ychB EG11294 orf; hypothetical protein 1262100-1262723 - CDS hemM EG11293 an enzyme in main pathway of synthesis of 5-aminolevulinate; possibly glutamyl-tRNA dehydrogenase 1262937-1264193 + CDS hemA EG10427 enzyme in alternate path of synthesis of 5-aminolevulinate

Reported regulatory sites for hemM: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.108 1262878-1262893 R tgctt GCATCATACAGGATGC gtaag - 0 - 1.814 1262899-1262921 R aataa TACCAACGTTGATAGGGTTAGTC tgctt - 0 - 1.814 1262854-1262876 R atgcg TAAGATCAATAAAAGAGAGCGCC ccctt - 0 - 1.693 1262788-1262808 R attaa GACAACTTGAACATAGACGAT agcgg - 0 - 1.693 1262730-1262750 R actgc AACGTATCTCAAGGACTTGTC atcac - 0 -

Critical MAP values: p=0.01 6.03 p=0.05 4.63 p=0.1 3.98 p=0.2 3.37

Click here to go back