hemN

Information for hemN, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 4048927-4049436 + CDS yihI EG11835 orf; hypothetical protein 4049619-4050998 + CDS hemN EG11836 O2-independent coproporphyrinogen III oxidase 4051449-4052858 - CDS glnG EG10385 response regulator for gln (sensor glnL) (nitrogen regulator I; NRI)

Reported regulatory sites for hemN: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.970 4049580-4049598 catcc GCCGGTACGCCGTAGCCGC cagag - 0 - 4.796 4049470-4049486 tgctg ATAACCCTTCCGGTTAT atgtt - 0 - 4.796 4049490-4049506 atatg TTATCTGGTGTGGTTAT tcgtt - 0 - 4.354 4049498-4049519 tctgg TGTGGTTATTCGTTAAACTACA gcggt - 0 - 4.167 4049527-4049550 ggttg TCGCGGCGACAAAAGTGGCTGCGC aaccg - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back