hepA

Information for hepA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 59687-60346 - CDS yabO EG12609 orf; hypothetical protein 60358-63264 - CDS hepA EG11083 probable ATP-dependent RNA helicase 63429-65780 - CDS polB EG10747 DNA polymerase II

Reported regulatory sites for hepA: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.221 63338-63354 R ccctt TCCATTCCTGGACCTGA ataac - 0 - 2.221 63285-63301 R ggtgg TTATTGCCTGCAATTAA agata - 0 - 1.663 63355-63377 R ctttg CCATCCAGTACCATAGCGCCCTT tccat - 0 - 0.695 63266-63284 R attaa AGATATAGAGCCGAACACA tatgc - 0 -

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back