hflK

Information for hflK, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 4398250-4399530 + CDS hflX EG10437 GTP - binding subunit of protease specific for phage lambda cII repressor 4399616-4400875 + CDS hflK EG10436 protease specific for phage lambda cII repressor 4400878-4401882 + CDS hflC EG10435 protease specific for phage lambda cII repressor

Reported regulatory sites for hflK: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.861 4399590-4399606 gatca CCGCATAACAAATATGG agcac - 0 - 1.597 4399562-4399585 atatc CTCTGGCGTCGAAAGACAACAGGG atcac - 0 - 0.363 4399540-4399560 gtagc GTCTGAAGCGTGGAGTCATAT cctct - 0 -

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back