himD

Information for himD, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 961218-962891 + CDS rpsA EG10900 30S ribosomal subunit protein S1 963051-963335 + CDS himD EG10441 integration host factor (IHF); beta subunit; site-specific recombination 963465-965807 + CDS ycaI EG12375 orf; hypothetical protein

Reported regulatory sites for himD: Genome coordinates Source Transcription factor Transcription factor annotation 962868-962915 DPInteract ihf integration host factor (IHF) 962942-962989 DPInteract ihf integration host factor (IHF)

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 7.801 962975-962996 gcact AAGGGCGGCTACGGCCGCCCTT aatca ihf 15 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.975 962901-962924 ctgac TCTTCGGGATTTTTATTCCGAAGT ttgtt - 0 - 2.758 962955-962971 aggtt TCGTCCTGTAATCAAGC actaa ihf 17 - 2.758 963025-963041 cttaa TTTGCCTTTAAGGAACC ggagg - 0 -

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back