hisJ

Information for hisJ, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2423250-2423936 - CDS hisQ EG12125 histidine transport system permease protein 2424026-2424808 - CDS hisJ EG12124 histidine-binding periplasmic protein of high-affinity histidine transport system 2425029-2425811 - CDS argT EG10072 lysine-; arginine-; ornithine-binding periplasmic protein

Reported regulatory sites for hisJ: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.891 2424966-2424987 R tcatg GTGCACGCCAGGTTTGTTGCAC tatcg - 0 - 2.236 2424816-2424834 R cccta TAAAAAGACTGTCAGTTGA ggaca - 0 - 1.896 2424930-2424950 R cattg AAATGCATACTTAAGCATTTT taatg - 0 -

Critical MAP values: p=0.01 7.30 p=0.05 6.05 p=0.1 5.26 p=0.2 4.60

Click here to go back