hisQ

Information for hisQ, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2422537-2423253 - CDS hisM EG10007 histidine transport; membrane protein M 2423250-2423936 - CDS hisQ EG12125 histidine transport system permease protein 2424026-2424808 - CDS hisJ EG12124 histidine-binding periplasmic protein of high-affinity histidine transport system

Reported regulatory sites for hisQ: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 0.986 2423994-2424013 R cggtg AAAGAAAGCCCGCTCCCTTC gggta - 0 - 0.874 2423941-2423959 R attca CCACACACGACAGGACAGG cagca - 0 -

Critical MAP values: p=0.01 6.03 p=0.05 4.63 p=0.1 3.98 p=0.2 3.37

Click here to go back