hisS

Information for hisS, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2636683-2637303 - CDS b2513 EG14209 orf; hypothetical protein 2637321-2638595 - CDS hisS EG10453 histidine tRNA synthetase 2638706-2639824 - CDS gcpE EG10370 orf; hypothetical protein

Reported regulatory sites for hisS: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 5.469 2638678-2638696 R gtgat GGGAAGCGCCTCGCTTCCC gtgta - 0 - 5.469 2638651-2638669 R tatga TTGAACCCGCATGGCTCCC gaaac - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.269 2638597-2638619 R tcatt TTTATATTCAGAAAGAGAATAAA cgtgg - 0 - 2.136 2638622-2638639 R ttgag GGAAGCGTTGAGGGTTCA ttttt - 0 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back