hlpA

Information for hlpA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 197928-200360 + CDS yaeT EG12676 orf; hypothetical protein 200482-200967 + CDS hlpA EG10455 histone-like protein; located in outer membrane or nucleoid 200971-201996 + CDS lpxD EG10316 UDP-3-O-(3-hydroxymyristoyl)-glucosamine N-acyltransferase; third step of endotoxin (lipidA) synthesis

Reported regulatory sites for hlpA: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.711 200439-200462 gcaaa GAACTGCACCCTCCGGTGCAAATG ggatg - 0 - 3.569 200421-200438 ataag ATCGCCGGGCCACGCAAA gaact - 0 - 2.501 200382-200398 aatgt AGTGGTAGTGTAGCGAT gactt - 0 -

Critical MAP values: p=0.01 7.30 p=0.05 6.05 p=0.1 5.26 p=0.2 4.60

Click here to go back