hnr

Information for hnr, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1288429-1289373 + CDS ychK EG12120 orf; hypothetical protein 1289465-1290478 + CDS hnr EG12121 Hnr protein 1290680-1291588 + CDS galU EG11319 glucose-1-phosphate uridylyltransferase

Reported regulatory sites for hnr: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.810 1289390-1289413 atcta CACTTAAGTTAATTCTGACAGGCG caggt - 0 - 2.810 1289434-1289457 tgcca CTATTGAGTAAAGCCAGTCAGGGG agaga - 0 - 0.733 1289418-1289433 gcagg TGGCAATAGCATGCCA ctatt - 0 -

Critical MAP values: p=0.01 6.03 p=0.05 4.63 p=0.1 3.98 p=0.2 3.37

Click here to go back