hns

hns

Information for hns, and also upstream and downstream flanking genes:

Genome coordinates	Orientation	Gene type	Name	EcoGene	Annotation
1290680-1291588	+	CDS	galU	EG11319	glucose-1-phosphate uridylyltransferase
1291732-1292145	-	CDS	hns	EG10457	DNA-binding protein HLP-II (HU; BH2; HD; NS); pleiotropic regulator
1292750-1293367	+	CDS	tdk	EG10994	thymidine kinase

Reported regulatory sites for hns:

Genome coordinates	Source	Transcription factor	Transcription factor annotation
1292160-1292179	DPInteract	cspA	cold shock protein 7.4 transcriptional activator of hns
1292450-1292474	PMID: 8830277	fis	site-specific DNA inversion stimulation factor; DNA-binding protein; a trans activator for transcription
1292415-1292433	PMID: 8830277	fis	site-specific DNA inversion stimulation factor; DNA-binding protein; a trans activator for transcription
1292341-1292368	PMID: 8830277	fis	site-specific DNA inversion stimulation factor; DNA-binding protein; a trans activator for transcription
1292287-1292310	PMID: 8830277	fis	site-specific DNA inversion stimulation factor; DNA-binding protein; a trans activator for transcription
1292243-1292260	PMID: 8830277	fis	site-specific DNA inversion stimulation factor; DNA-binding protein; a trans activator for transcription

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05):

Avg. MAP

Genome coordinates

Sequence

Site type

Overlap (bp)

Repeat

Model logo

Prediction logo

Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05):

Avg. MAP	Genome coordinates	Sequence	Site type	Overlap (bp)	Repeat	Model logo	Prediction logo	Prediction alignment
4.400	1292267-1292288 R	ctggc TAATTTTATGAAAAGATATTTA ttggc	fis	2	-
4.400	1292186-1292207 R	acaac TGAATTTAAGGCTCTATTATTA cctca	-	0	-
2.712	1292155-1292172 R	aacca CCCCAATATAAGTTTGAG attac	cspA	13	-
2.220	1292231-1292254 R	cacaa AATAAAGAACAATTTTGAATTCCT tacat	fis	12	-

Critical MAP values: