holD

Information for holD, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 4604238-4605269 - CDS yjjT EG12596 putative enzyme 4605372-4605785 + CDS holD EG11414 DNA polymerase III; psi subunit 4605754-4606200 + CDS rimI EG10850 acyltransferase for 30S ribosomal subunit protein S18; acetylation of N-terminal alanine

Reported regulatory sites for holD: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 7.634 4605345-4605364 atttg CGCCCCTGACAACAGGAGCG attcg - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 5.176 4605296-4605317 tggcg GCGATTATAGCCATATGTTGGC gcggt - 0 - 3.798 4605288-4605304 attga TACTGGCGGCGATTATA gccat - 0 -

Critical MAP values: p=0.01 7.30 p=0.05 6.05 p=0.1 5.26 p=0.2 4.60

Click here to go back