holE

Information for holE, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1922619-1922993 - CDS b1841 EG14029 orf; hypothetical protein 1923132-1923362 + CDS holE EG11505 DNA polymerase III; theta subunit 1923464-1924120 + CDS b1843 EG14030 orf; hypothetical protein

Reported regulatory sites for holE: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.562 1923051-1923070 tgtct GAGTCGAGGATCATCAATTC cggct - 0 - 4.067 1923007-1923030 ttcct TTTTGTAATAACTTTTTTACAGAG cataa - 0 - 0.043 1923094-1923117 cactc TTAGTAACTTTTGCCCGCGAATGA tgagg - 0 -

Critical MAP values: p=0.01 7.30 p=0.05 6.05 p=0.1 5.26 p=0.2 4.60

Click here to go back