hpt

Information for hpt, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 138835-141225 - CDS gcd EG10369 glucose dehydrogenase 141419-141967 + CDS hpt EG20098 hypoxanthine phosphoribosyltransferase 142008-142670 - CDS yadF EG12319 putative carbonic anhdrase (EC 4.2.1.1)

Reported regulatory sites for hpt: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.729 141307-141326 aattc GAGCTTTATTAACAGATTCC gcgaa - 0 - 2.729 141399-141418 gcgaa GTGATTTGTTTTTAAATCAT atggt - 0 - 1.242 141237-141254 acacc ATTTCAATTCATTAATAT tttag - 0 - 1.242 141278-141295 taggt TTTAACATGTGTGATCGT catca - 0 - 1.230 141296-141312 atcgt CATCACAATTCGAGCTT tatta - 0 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back